Hi there, would love some assistance with a rhesus macaque custom primer error. I spiked a mix of custom primers into a human 10x vdj library prep kit, and the reverse complement sequences are clearly found in my vdj reference (Mmul10), which I built using cellranger mkvdjref. However, my pipeline is breaking, as below:

Command executed:

  cellranger \
      vdj \
      --id='1486_MLN_BCR' \
      --fastqs=. \
      --reference=Mmul_10_IMGT_vdj \
      --localcores=8 \
      --localmem=16 \
      --inner-enrichment-primers /nfs/roberts/project/pi_lk595/tar37/NHP_GI/BCR_analysis/nhp_bcr_primers_RC.fasta
  
  cat <<-END_VERSIONS > versions.yml
  "NFCORE_AIRRFLOW:AIRRFLOW:SC_RAW_INPUT:CELLRANGER_VDJ":
      cellranger: $(echo $( cellranger --version 2>&1) | sed 's/^.*[^0-9]\([0-9]*\.[0-9]*\.[0-9]*\).*$/\1/' )
  END_VERSIONS

Command exit status:
  1

Command output:
  Martian Runtime - v4.0.12
  Serving UI at <http://a1130u05n01.mghpcc.ycrc.yale.edu:35431?auth=LbRzWFVVD11hMRrDkaHC1qp9CefwOD7dxm21n6FPInM>
  
  Running preflight checks (please wait)...
  Checking sample info...
  Checking FASTQ folder...
  Checking reference...
  Checking reference_path (/nfs/roberts/project/pi_lk595/tar37/NHP_GI/BCR_analysis/Mmul_10_IMGT_vdj) on a1130u05n01.mghpcc.ycrc.yale.edu...
  Checking inner enrichment primers...
  Checking enrichment primers (/nfs/roberts/project/pi_lk595/tar37/NHP_GI/BCR_analysis/nhp_bcr_primers_RC.fasta) on a1130u05n01.mghpcc.ycrc.yale.edu...
  
  [error] None of the C-REGIONs in the reference /nfs/roberts/project/pi_lk595/tar37/NHP_GI/BCR_analysis/Mmul_10_IMGT_vdj is targeted by the following inner enrichment primer(s): CACTCAACGTGACCTGGAGCAA, CAAAGTCCGTGACTGTCACCTG, AAGCACTATGACCTTACCAGCC, TCCTACAGTCCTCAGGGCT, CCTCGTCTCCTGTGAGAATGC, CTCTGTTGTGTGCCTGCTGAAT, CAAGGCCACACTAGTGTGTCT.

nf-core/airrflow 4.3.0
------------------------------------------------------
Input output options
  input                     : Nine_runs.tsv
  outdir                    : 515_nine_runs_output

Protocol
  library_generation_method : sc_10x_genomics

Single cell analysis options
  reference_10x             : Mmul_10_IMGT_vdj

Clonal analysis options
  clonal_threshold          : 0.2

Institutional config options
  config_profile_name       : mccleary
  config_profile_description: McCleary Cluster at Yale
  config_profile_contact    : Gisela Gabernet, @ggabernet
  config_profile_url        : <https://docs.ycrc.yale.edu/clusters/mccleary/>

Generic options
  trace_report_suffix       : 2026-05-15_15-30-32

Core Nextflow options
  revision                  : 4.3.0
  runName                   : wise_ritchie
  containerEngine           : singularity
  launchDir                 : /nfs/roberts/project/pi_lk595/tar37/NHP_GI/BCR_analysis
  workDir                   : /nfs/roberts/project/pi_lk595/tar37/NHP_GI/BCR_analysis/work
  projectDir                : /home/tar37/.nextflow/assets/nf-core/airrflow
  userName                  : tar37
  profile                   : mccleary
  configFiles               :

Hi Tyler @Tyler Rice, currently the supported species of nf-core/airrflow pipeline are only human and mouse. We did not test the behavior on running the pipeline on other species.

Hi @Tyler Rice, to expand on this a bit, it looks like it's cellranger that is having some issues with the provided primers andreference. Did you manage to run cellranger for this data outside of the airrflow pipeline? I would try that first. But as Huimin mentioned, the scope of airrflow is to support human and mouse data, we cannot ensure it will run on other species

Got it thank you! I have got it running by pointing to a human reference instead of macaca mulatta.