https://nf-co.re logo
Join Slack
Powered by
# smrnaseq
  • b
    Hello I’m new to smrnaseq and I have some doubts regarding the trimming step. I’ve been provided some samples processed with the D-Plex Small RNA DNBSEQ™ kit. According to the manual (see the PDF) in page 32, the manufacturer recommends trimming the 3’ and 5’ adaptors, as well as the polyA tail. In smrnaseq I found the 
    --three_prime_adaptor
    parameter to trim the 3’ adaptor, so no problem there, but I found no parameter for trimming the 5’ adaptor. Also to remove the polyA tail present near the 3’ end, I’m thinking of using the 
    --three_prime_clip_r1
    parameter. In my case, the tail is composed of AAAAA, so if I’m not wrong, I should set it to 
    5
    ? Lastly, my samples have a Template Swtch Motif (TSM) of 3 nucleotides at 5’, between the actual read and the 5’ adaptor (see the picture or page 29 of the PDF). I’m not very sure if I should take it away or not as the manufacturer doesn’t say anything about it but it’s not part of the biological sequence we want to study. If I manage to take away the 5’ adaptor beforehand, I guess that I could use the 
    --clip_r1
    parameter set to 
    3
    to erase the last 3 bases, but please correct me if I’m wrong. The other solution I think of is just manually trimming the samples with cutadapt, using the command given by the manufacturer, and try to skip the trimming process in smrnaseq by setting 
    --trim_fastq
    to 
    FALSE
    , but if possible I would want to be able to correctly trim the samples within the smranseq pipeline. Thanks!
    t
    • 2
    • 3
  • r
    Trying to figure out how to get the mirTOP output into IsoMIR R package for analysis and plotting. Is there a good right up for this? I have 18 samples across 4 conditions. I cannot for the life of me figure out which file to use. The official isomiR package seems to suggest I use individual rawData.tsv from mirTOP. However I see there are two tsv files in the output. One is joined_samples_mitop.tsv and another is mirna.tsv. Which to use for starting isomiR analysis? More importantly, how???
    l
    • 2
    • 13
  • n
    Hello, I just launched an nf-core/smrnaseq pipeline using version 2.4.0. I would like to know if the file 
    mmu.gff3
    will be used for miRNA annotation, as this file is generated based on the GRCm38 genome. However, the GRCm39 genome is available. I'm wondering whether I need to perform any additional steps on my end at this stage (such as LiftOver, for example). I'm using the following parameters: { "input": "mirna.csv", "outdir": "results", "multiqc_title": "mirna_mirbase_mmu", "save_intermediates": true, "mirtrace_species": "mmu", "fasta": "genome/Mus_musculus.GRCm38.dna.primary_assembly.fa.gz", "mirna_gtf": "https://mirbase.org/download/mmu.gff3", "three_prime_adapter": "AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC", "fastp_max_length": 27 }
    l
    • 2
    • 9
  • j
    Hello, it's the first time I post on this channel. First of all, thanks for setting up this pipeline. I am using it to perform analysis of smRNA-seq library made in Arabidopsis thaliana. It's the first time I am performing this type of analysis and also the first time in plant. I have a question regarding the proportion of ribosomal RNA expected in such library. I am using public datasets and the M&M are not really detailed so I don't know if they tried to deplete the rRNAs before the sequencing. But in 2 independent articles when I run the analysis I see that most reads that have a length above 18nt are matching rRNA according to miRTrace report. There are still reads mapping to known miRNA but they represent 500k reads out of 200M. Can someone enlighten me?
    l
    • 2
    • 16
  • b
    Hello, it’s my first time trying the smranseq pipeline and I am having some issues. I’m analysing some samples and I want to check both databases available (miRbase and MirGeneDB). miRbase is working properly and the pipeline finishes correctly, but when I set the pipeline to use MirGeneDB I’m getting empty gff files from the 
    MIRTOP_GFF
    process and then an error in a later in a 
    MIRTOP_STATS
    process due to those empty files. I’m attaching an example of one of those empty gff files, and also a multiQC file of the miRbase analysis on the exact same samples that whent smoothly. I only changed the 
    mirgenedb
    parameter from 
    true
    to 
    false
    for the MirGeneDB analysis in the parameters file. I forgot to mention but the samples have been prevously trimmed so I'm telling smrnaseq not to do any trimming at all (or at least I tried so). The error also mentions a deprecated 
    Bio.pairwise2
    Python package, which would probably require a pipeline update, but I suspect that there must be another problem on my side as I encountered this error before in the miRbase analysis and finally it disappeared once I configured properly the parameters file.
    .nextflow_MirGeneDB.logV350307986_10.fq.gz_mirtop.gffRun_smrnaseq_Danio_rerio_MirGeneDB.shV350307986_10.fq.gz.gffnf-params_MirGeneDB.jsonold_multiqc_miRBase_succesfull.html
    l
    • 2
    • 2
  • n
    Hello, I ran several executions with the same parameters, but the results obtained with mirtop show slight variations each time. During the differential expression analyses — given the low number of genes and the presence of many duplicates, as well as multimapping during the mapping step — some genes near the significance threshold appear as significant in some runs and not in others. The total number of differentially expressed genes also fluctuates slightly. Although certain genes consistently appear as significant across runs, there is still variability, with some genes appearing or disappearing depending on the execution. Has this ever happened to you? How do you usually handle this kind of issue? Should I try changing the seed, or adjust other parameters? Thx you :))
  • j
    Hello, i am trying to process small RNA seq data and gather info on miRNA, snoRNA and snRNA. Right now, I am trying out the smrnaseq pipeline to see what results i get, but i noticed i only get miRNA info, so i was wondering if any has ever tried to get miRNA, snoRNA and snRNA counts, and if so how did you manage it. thank you very much
  • e
    Hello all, #importantquestion The Qiagen library prep kit uses miRNA sequences that should be removed according to the "QIAseq™ miRNA Library QC PCR Handbook" protocol. I was wondering whether this step is already included or if it is necessary to specify the sequence with 
    --other_contamination
    Many thanks!!
    t
    • 2
    • 1
  • j
    Hello all, I have a question wrt the rational of running mirtrace after the trimming of the 3'adapter in the read. While testing the pipeline with the positive control given by the mirtraceQC package, the reports shows that no 95% of the reads given to mirtrace show no detection of the adapter. This makes sense since the input of mirtrace is the output of fastp where the reads are trimmed. But I was wondering if this make sense for the pipeline to run in that order?
    l
    • 2
    • 1
  • j
    Hello all, I am trying to analyse small non-coding RNA in stool and plasma samples, and I am having problems with alignment percentages and annotation. For this purpose, I am trying out the nf-core/smrnaseq pipeline, which only outputs miRNA results, and I wanted to know if it is possible to change the reference genome to align to miRNA, snoRNA and snRNA and annotate it. thank you!
    t
    l
    ö
    • 4
    • 15
  • b
    Hello! I’m still testing the smrnaseq pipeline. This time I downloaded some public data (https://www.ebi.ac.uk/ena/browser/view/PRJEB13938?show=reads) from this experiment (https://www.ebi.ac.uk/biostudies/ArrayExpress/studies/E-MTAB-4683?query=E%E2%80%90MTAB%E2%80%904683). It’s the species is A thaliana. My goal is to perform the most complete analysis possible with this pipeline, so I downloaded rRNA, tRNA, ncRNA and cDNA files for filtering. This time I’m using miRBase only as there is no info about A thaliana in MirGeneDB. Previously I had errors only when using MirGeneDB but they solved as soon as I changed to the 
    dev
    branch of the pipeline. The problem Is that the error rises again, even when using the 
    dev
    branch with miRBase. I attach the log files for more info but the error seems to be related to 
    NFCORE_SMRNASEQ:MIRNA_QUANT:BAM_STATS_MIRNA_MIRTOP:MIRTOP_STATS
    and I suspect it being due to a 
    .gff
    file being empty but I don’t understand why. Any help is very appreciated.
    .nextflow.logsmrnaseq_job-141939.log
    t
    • 2
    • 1
  • r
    Asking the experts of miRNAs here: do anyone know a good pipeline that can be used to predict miRNA to mRNA targets? Working with non model organism is difficult lol
    👀 1
  • j
    #CE8SSJV3N Hello everyone! i am using the rnaseq pipeline and everything ran well until i got an error duing MultiQC process. Has anyone got this error before? how can i fix it? thank you very much
    Copy code
    Error executing process > 'NFCORE_RNASEQ:RNASEQ: MULTIQC (1)'

Caused by:
  Process `NFCORE_RNASEQ:RNASEQ:MULTIQC (1)` terminated with an error exit status (132)


Command executed:

  multiqc \
      --force \
       \
      --config multiqc_config.yml \
      --filename multiqc_report.html \
       \
       \
      --replace-names name_replacement.txt \
       \
      .
  
  cat <<-END_VERSIONS > versions.yml
  "NFCORE_RNASEQ:RNASEQ:MULTIQC":
      multiqc: $( multiqc --version | sed -e "s/multiqc, version //g" )
  END_VERSIONS

Command exit status:
  132

Command output:
  (empty)

Command error:
  .command.sh: line 11:    33 Illegal instruction     multiqc --force --config multiqc_config.yml --filename multiqc_report.html --replace-names name_replacement.txt .

Work dir:
  /Users/janinesoares/nf_core_workDir/c1/79ee5d3a87a1fb4fead7dfb9eb5216

Container:
  <http://quay.io/biocontainers/multiqc:1.29--pyhdfd78af_0|quay.io/biocontainers/multiqc:1.29--pyhdfd78af_0>
    m
    • 2
    • 2
  • b
    Hello! I’ve been analysing some microRNAseq data with smrnaseq. The visualizations made by the pipeline are very handy but I’d like to do further analysis on my own. I would want to import the raw counts to edgeR or DESeq2. So far I found these CSV files in 
    results/mirna_quant/edger_qc /[mature/hairpin]_counts.csv
    . I guess those are the raw counts, but I would be thankful if someone could confirm me that. Also, there is another interesting file in 
    results/mirna_quant/mirtop/mirna.tsv
    , that I don’t fully understand jet what it is. Thanks!
    ❤️ 1
    t
    • 2
    • 1
  • j
    Hi! This pipeline didn't get a template update with tools 3.3.2 due to the missing value for 
    manifest.contributors
    in the 
    nextflow.config
    file. Please make sure to complete the template update for v3.3.1 and add the 
    contributors
    field. You can read the blog post about the 3.3.1 template update and ping us if you encounter any problem. Once you changed that in your 
    dev
    branch, you will be able to continue receiving template updates.
  • u
    Hello everyone! I'm new to the pipeline. While I was testing the pipeline with multiple samples, it went smoothly, except that in the mapping genome step, only one sample was being processed. Here is the MultiQC report and the log. Any suggestions for this situation? Thank you very much!
    multiqc_report.html.nexflow.log
    t
    • 2
    • 3
  • g
    Hi. I a running this pipeline with multiple samples and I am getting an error with mirtop. This is the error message I get:
    Copy code
    ERROR ~ Error executing process > 'NFCORE_SMRNASEQ:MIRNA_QUANT:BAM_STATS_MIRNA_MIRTOP:MIRTOP_GFF (IGtrES_12)'

Caused by:
  Process `NFCORE_SMRNASEQ:MIRNA_QUANT:BAM_STATS_MIRNA_MIRTOP:MIRTOP_GFF (IGtrES_12)` terminated with an error exit status (1)


Command executed:

  mirtop \
      gff \
       \
      --sps dre \
      --hairpin hairpin.fa_igenome.fa_idx.fa \
      --gtf dre.gff3 \
      -o mirtop \
      IGtrES_12.bam
  
  mv mirtop/mirtop.gff mirtop/IGtrES_12_mirtop.gff
  
  cat <<-END_VERSIONS > versions.yml
  "NFCORE_SMRNASEQ:MIRNA_QUANT:BAM_STATS_MIRNA_MIRTOP:MIRTOP_GFF":
      mirtop: $(echo $(mirtop --version 2>&1) | sed 's/^.*mirtop //')
  END_VERSIONS

Command exit status:
  1

Command output:
  ['gff', '--sps', 'dre', '--hairpin', 'hairpin.fa_igenome.fa_idx.fa', '--gtf', 'dre.gff3', '-o', 'mirtop', 'IGtrES_12.bam']

Command error:
  /opt/conda/lib/python3.12/site-packages/Bio/pairwise2.py:278: BiopythonDeprecationWarning: Bio.pairwise2 has been deprecated, and we intend to remove it in a future release of Biopython. As an alternative, please consider using Bio.Align.PairwiseAligner as a replacement, and contact the Biopython developers if you still need the Bio.pairwise2 module.
    warnings.warn(
  03/11/2013 05:55:15 INFO Run annotation
  03/11/2013 05:55:15 ERROR Database not found in --mirna dre.gff3. Use --database argument to add a custom source.
  Traceback (most recent call last):
    File "/opt/conda/bin/mirtop", line 10, in <module>
      sys.exit(main())
               ^^^^^^
    File "/opt/conda/lib/python3.12/site-packages/mirtop/command_line.py", line 31, in main
      reader(kwargs["args"])
    File "/opt/conda/lib/python3.12/site-packages/mirtop/gff/__init__.py", line 24, in reader
      database = mapper.guess_database(args)
                 ^^^^^^^^^^^^^^^^^^^^^^^^^^^
    File "/opt/conda/lib/python3.12/site-packages/mirtop/mirna/mapper.py", line 23, in guess_database
      return _guess_database_file(args.gtf, args.database)
             ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^
    File "/opt/conda/lib/python3.12/site-packages/mirtop/mirna/mapper.py", line 40, in _guess_database_file
      raise ValueError("Database not found in %s header" % gff)
  ValueError: Database not found in dre.gff3 header

Work dir:
  /share/data05/gthemudo/a2s/ignition/mirna/data/transport/work/75/3a71a11eaf4ab49607740860af8b07

Container:
  /share/data05/gthemudo/a2s/ignition/mirna/data/transport/work/singularity/community.wave.seqera.io-library-mirtop_pybedtools_pysam_samtools_pruned-60b8208f3dbb2910.img

Tip: you can try to figure out what's wrong by changing to the process work dir and showing the script file named `.command.sh`

 -- Check '.nextflow.log' file for details
Execution cancelled -- Finishing pending tasks before exit
ERROR ~ Pipeline failed. Please refer to troubleshooting docs: <https://nf-co.re/docs/usage/troubleshooting>

 -- Check '.nextflow.log' file for details
    In the work directory there is a dre.gff3 file that is not empty. So I am not sure why it is throwing an error.
    t
    • 2
    • 2
  • s
    Dear All, I've been using the pipeline for a while for mouse and human miRNAseq data. While the mouse genomes didn't have any issues, the human genomes are having a peculiar one. Specifically, the reference miRNA mapping rate have been poor (see attached multiqc plots). Incidentally, the difference in the plots arose from a University bioinformatics core who generated the data, used the 
    -profile 'qiaseq'
    parameter for version 2.3.1 but when I used it, it didn't make any difference in the mapping rate. I've been trying to solve this issue for 3 days, without any solution. Any help is much appreciated. Thanks in advance. P.S - Since the 2 runs differed in number of samples but sample11 is common between them.
  • m
    Hello all, I'm new to nextflow (coming from a Snakemake background) so I'm trying to get a feel for how these pipelines work. I'm trying to run a small sample set through the smrnaseq pipeline locally but keep running into this error: (I have access to an HPC, but have not been able to get the test data provided by the pipeline to work with singularity and have a time crunch. The test profile works with docker locally for me, so thats how I am rolling for now...)
    Copy code
    Pipeline completed with errors-
ERROR ~ Error executing process > 'NFCORE_SMRNASEQ:CONTAMINANT_FILTER:INDEX_TRNA (hg38-tRNAs.fa)'

Caused by:
  Process requirement exceeds available memory -- req: 72 GB; avail: 64 GB
    I've tried a few things to get around this: 1. Included a custom config with -c: (same error)
    Copy code
    # local.config
process {
  cpus   = 8
  memory = 62.GB
}
    2. Added the following line to nextflow.config (same error)
    Copy code
    process {
    memory = '62.GB'
    The command I am using to run the pipeline is as follows: 
    nextflow run nf-core/smrnaseq -profile docker -params-file params.yaml
    My params.yaml is as follows:
    Copy code
    input: './samplesheet.csv'
outdir: './results'
genome: 'GRCh38'
mirtrace_species: 'hsa'
save_intermediates: true
filter_contamination: true
trna: '<http://gtrnadb.ucsc.edu/genomes/eukaryota/Hsapi38/hg38-tRNAs.fa>'
cdna: '<ftp://ftp.ensembl.org/pub/release-86/fasta/homo_sapiens/cdna/Homo_sapiens.GRCh38.cdna.all.fa.gz>'
ncrna: '<ftp://ftp.ensembl.org/pub/release-86/fasta/homo_sapiens/ncrna/Homo_sapiens.GRCh38.ncrna.fa.gz>'
    If anyone has any insight as to how I can fix this that would be great!
    t
    • 2
    • 2
  • c
    Hello all, I've quite the same kind of issue than @Michael Martinez. I'm trying to run the smrnaseq pipeline ver 2.4.1. I've used in the past old version of the pipeline. Currently I'm stuck, because I keep getting the 
    Process requirement exceeds available memory
    message.
    Copy code
    ERROR ~ Error executing process > 'NFCORE_SMRNASEQ:UMICOLLAPSE_FASTQ (MO2025_03_2_07)'

Caused by:
  Process requirement exceeds available memory -- req: 200 GB; avail: 125.5 GB


Command executed:

  # Getting the umicollapse jar file like this because `umicollapse` is a Python wrapper script generated
  # by conda that allows to set the heap size (Xmx), but not the stack size (Xss).
  # `which` allows us to get the directory that contains `umicollapse`, independent of whether we
  # are in a container or conda environment.
  UMICOLLAPSE_JAR=$(dirname $(which umicollapse))/../share/umicollapse-1.1.0-0/umicollapse.jar
  java \
      -Xmx184320M \
      -Xss999M \
      -jar $UMICOLLAPSE_JAR \
      fastq \
      -i MO2025_03_1_08_S6_R1_001.fastq.gz \
      -o MO2025_03_1_08.umi_dedup.sorted.fastq.gz \
      --algo dir --two-pass | tee MO2025_03_1_08.umi_dedup.sorted_UMICollapse.log
  
  cat <<-END_VERSIONS > versions.yml
  "NFCORE_SMRNASEQ:UMICOLLAPSE_FASTQ":
      umicollapse: 1.1.0-0
  END_VERSIONS

Command exit status:
  -

Command output:
  (empty)
    I've used, and still using, quite a large number of nf-core pipeline. On different workstations (still waiting for an installation on our HPC). I've had quite a lof of issues and bugs in the past. But these error messages are new for me. I've tried to modify by hand the UMICOLLAPSE:main.nf in order to hard coded the allocated memory. No luck. I've put 
    def max_heap_size_mega = 20000
    and the process keeps asking for 200 Gb.
    Copy code
    ERROR ~ Error executing process > 'NFCORE_SMRNASEQ:UMICOLLAPSE_FASTQ (MO2025_03_2_07)'

Caused by:
  Process requirement exceeds available memory -- req: 200 GB; avail: 125.5 GB


Command executed:

  # Getting the umicollapse jar file like this because `umicollapse` is a Python wrapper script generated
  # by conda that allows to set the heap size (Xmx), but not the stack size (Xss).
  # `which` allows us to get the directory that contains `umicollapse`, independent of whether we
  # are in a container or conda environment.
  UMICOLLAPSE_JAR=$(dirname $(which umicollapse))/../share/umicollapse-1.1.0-0/umicollapse.jar
  java \
      -Xmx20000M \
      -Xss999M \
      -jar $UMICOLLAPSE_JAR \
      fastq \
      -i MO2025_03_2_07_S11_R1_001.fastq.gz \
      -o MO2025_03_2_07.umi_dedup.sorted.fastq.gz \
      --algo dir --two-pass | tee MO2025_03_2_07.umi_dedup.sorted_UMICollapse.log
    My nextflow is up-to-date and I've dowloaded the pipeline on the same computer.
    Copy code
    nextflow -v
nextflow version 25.10.2.10555
    I'm using the following command:
    Copy code
    nextflow run \
/mnt/ssd/Nextflow/nf-core-smrnaseq/2_4_1/ \
-profile singularity \
-params-file /XXXXXXXXXXX/data/params.yml
    with the parameters:
    Copy code
    input: "/XXXXXXXXXXX/data/samplesheet.csv"
outdir: "/XXXXXXXXXXX/results/"
protocol: "qiaseq"
mirgenedb: true
mirgenedb_species: "rno"
mirgenedb_gff: "/XXXXXXXXXXX/mirgene/rno.gff"
mirgenedb_mature: "/XXXXXXXXXXX/mirgene/rno-mature.fas"
mirgenedb_hairpin: "/XXXXXXXXXXX/mirgene/rno-pre.fas"
genome: Rnor_6.0
fasta: /XXXXXXXXXXX/references/Rattus_norvegicus/Ensembl/Rnor_6.0/Sequence/WholeGenomeFasta/genome.fa"
bowtie_index: "/XXXXXXXXXXX/references/Rattus_norvegicus/Ensembl/Rnor_6.0/Sequence/BowtieIndex"
with_umi: true
umitools_extract_method: "regex"
umitools_bc_pattern: '.+(?P<discard_1>AACTGTAGGCACCATCAAT){s<=2}(?P<umi_1>.{12})(?P<discard_2>.*)'
skip_fastp: true
multiqc_title: "MultiQC Projet XXXXX - analyses miRNA"
filter_contamination: true
trna: "/XXXXXXXXXXX/tRNA/rn6-mature-tRNAs.fa"
cdna: "/XXXXXXXXXXX/fasta/Rattus_norvegicus.GRCr8.cdna.all.fa"
ncrna: "/XXXXXXXXXXX/fasta/Rattus_norvegicus.GRCr8.ncrna.fa"
    Does that mean my max avalaible memory is hard coded somewhere?
    p
    • 2
    • 7
  • u
    not sure if this is the best place to put this, but ive been trying to understand some of the paranmeters used the the smrnaseq pipeline https://github.com/nf-core/smrnaseq/tree/master. specifically I'm trying to understand how many mismatches are allowed during mature miRNA and hairpin alignment, so I can understand if reads with A/U tailing will be alignmed (mainly in the hairpin context). my understanding was that no mismatches were generally allowed for at least the mature mirna mapping to avoid cross mapping to similar miRNAs, but looking at the bowtie command specification it doesnt seem like any specific parameters to limit mismatches are used in the mature or hairpin mapping. looking at the reads from the mature mapping in IGV however, I dont really ever see any mismatching bases.. hoping someone might be able to help me understand..
    t
    • 1
    • 6
  • r
    Hi all, I noticed in the documentation that in the Usage tab a warning that states to use the --skip-fastq parameter to avoid trimming the adapters before using umi-tools extract. I am confused, though, because according to the introduction the optional UMI extraction and miRNA adapter trimming (1.2) happens prior to the fastp adapter trimming step (1.3). Is it necessary to skip fastp, then? I may be misunderstanding. I am trying to do an analysis on data from a QIAseq kit. I am putting my current command here, in case that is helpful.
    Copy code
    nextflow run nf-core/smrnaseq \
    -name "smrnaseq_${BASENAME}_${SLURM_JOB_ID}" \
    -profile singularity \
    --input ${SAMPLESHEET} \
    --outdir ${RESULTS_DIR} \
    --genome ${GENOME} \
    --mirtrace_species hsa \
    --with_umi true \
    --umitools_extract_method regex \
    --umitools_bc_pattern '.+(?P<discard_1>AACTGTAGGCACCATCAAT){s<=2}(?P<umi_1>.{12})(?P<discard_2>.+)' \
    --protocol qiaseq \
    --skip_mirdeep false \
    --max_cpus 16 \
    --max_memory 50.GB \
    --skip_fastp \
    -w ${WORK_DIR} \
    -resume
    👍 1
  • m
    Hi all, Curious to know if the input for mirtop is the hairpin alignments. From the mirtop documentation it would seem like this is the case, but tracking the processes back in the execution report it appears that smrnaseq is using seqcluster collapsed reads as input for mirtop.
  • m
    Was able to track down that the input for mirtop is basically seqcluster collapsed reads (trimmed reads that have collapsed and then re-mapped back to the full genome.) Is this summary correct: reads are trimmed/UMIs removed --> mapped with seqbuster, collapsed with seqcluster --> aligned to genome --> this bam is input to mirtop?
    t
    • 2
    • 4
  • t
    Hi all, I am new to smRNA processing and wanted to make sure I am interpreting the output correctly in the multiQC. Specifically, the 
    mature_hairpin_genome
    are reads aligned to mature miRNA database + hairpin database + reference genome. A high mapping percentage of 
    mature_hairpin_genome
    relative to 
    mature
    and 
    mature_hairpin
    would otherwise indicate that the majority of reads are mapping to regions of the genome outside of known mature miRNAs and precursors
    smRNA_Example_multiqc_report.html
    • 1
    • 1
  • p
    Hello, I've seen this request of enhancement https://github.com/nf-core/smrnaseq/issues/356 do you think it may be worth adding command line support for the extra arguments?
  • b
    Hiya!! My question pertains to the nf-core/smrnaseq pipeline. The smrnaseq libraries I am processing through this pipeline had their libraries prepared using the 'Takara SMARTer smRNA-Seq Kit for Illumina' that does not use UMIs. They also suggest in their manual (Pg 13) how to trim the reads using cutadapt (cutadapt -m 15 -u 3 -a AAAAAAAAAA input.fastq > output.fastq). Should I still set my profile option as "_-profile_ singularity,illumina", or should I just set it as "_-profile_ singularity" and set _--trim_fastq_ false and feed the pipeline with trimmed reads to begin with? My sequencing is PE 151bp. Thread in Slack conversation
  • l
    Hi, the pipeline will only accept read 1. i don't remember all options, but you can check the config file for each technology (like illumina) and create one that fits your protocol.
  • n
    Hello, I was wondering how does the pipeline handles mature miRNAs that have identical sequences but come from different hairpins (for example, hsa-miR-512-5p and hsa-miR-498-5p) in mirtop output (the mirna.tsv table) ? I understand that the idential miRNAs will have same UIDs and we will only keep one of them, but what about the variants? I mean, lets suppose that the mature miRNA A is identical to miRNA B, so counts of the exact mature (e.i. NA variant) is assigned to for example miRNA A. But then we have a counts of a variant that is unique to miRNA B, the counts assigned to miRNA B will only come from this variant? Just trying to understand how to interpret the counts here. Thanks!
  • t
    depictio Depictio dashboard for smrnaseq: feedback wanted Depictio (open source, from EMBL) turns the output of a workflow run into an interactive dashboard you can share, so nobody has to write a Shiny or Streamlit app for each project. Point a template at any run of a pipeline and you get the same dashboard, which you can edit (UI & YAML), version and comment. 🧬 The smrnaseq dashboard template shows library QC, miRNA expression by group, library PCA and a two-group test, isomiRs and novel miRNAs proposed by miRDeep2. 🙌 We need your help! Feedback and ideas welcome in #C0AFS06G9HR (all templates and details there) or in the smrnaseq GitHub discussion.
    🎉 1