https://nf-co.re logo
Join Slack
Powered by
# crisprseq
  • s
    This message was deleted.
    l
    d
    • 3
    • 19
  • e
    Hello!! I am dealing with CRISPRi data, where I have 3 main "cell types" WT. heterozigous, homozigous. 2 timepoints, d0 and d31. And 2 biological replicates. 1. Is there any way of indicating in the pipeline that I have 2 replicates per condition? 2. What we are interested in, is in compare the "progression" (d31vsd0) of the different cell types. So progression of WT vs progression of homozigous, etc. To do so with this pipeline, it can only be done by doing pairwise comparisons within the same cell type (d0 vs d31) and compare then, "manually" the results and outputs extracted between different progressions, right? Thanks a lot guys! Eric
    l
    k
    • 3
    • 14
  • p
    Hello, how can I run multiple design matrices for MLE within on nextflow run of the pipeline? The usage documentation was ambiguous. Thanks!
    l
    • 2
    • 7
  • a
    Hi, I am trying to run mle and here's the error that I am not sure about. Can someone help?
    j
    • 2
    • 2
  • a
    Hi, the pipeline finished running but I FluteMLE is empty. I also tried to run rra but using contrast but no output. Wondering what happened?
    Copy code
    nextflow run nf-core/crisprseq -r dev --input sample_w_control.csv --mle_design_matrix design_matrix.txt --library mageck_library.tsv --analysis screening --contrasts contrast.csv --outdir output_withContrast  -profile conda
    j
    • 2
    • 1
  • a
    Hi there. I need to use the --reverse-complement flag with Mageck count. I wonder if you could add this to the pipeline?
    j
    • 2
    • 1
  • d
    Hello! Running the pipeline using 
    mageck mle
    I notice that the resulting 
    .sgrna_summary.txt
    output file predicts all sgRNAs have an efficiency of exactly 1. This seems to indicate the sgRNA efficiency component of the pipeline is either failing or not being run at all. Is there any way to diagnose what is going on here? Does the pipeline actually have the ability to incorporate sgRNA efficiency predictions? My command is as below:
    Copy code
    nextflow run nf-core/crisprseq \
    --analysis screening \
    --outdir results \
    --input samplesheet.csv \
    --library library.txt \
    -profile docker \
    --mle \
    --contrasts contrasts.csv
    And the output of the 
    .sgrna_summary.txt
    file looks like this:
    Copy code
    Gene	sgRNA	eff
CREBBP	GCAAGGTCGGGCCAGACACC	1
CREBBP	GGCGCAGGCGCACTGCGATC	1
    l
    a
    • 3
    • 6
  • a
    Hi, I tried to use the gene_summary.txt file by following https://bioconductor.org/packages/release/bioc/vignettes/MAGeCKFlute/inst/doc/MAGeCKFlute.html tutorial and when I do log10 of the FDR of the treated, I get no results. My goal is to get the enriched and depleted genes. What would be the best tool for this kind of analysis?
    Copy code
    But when I use: 

gdata_cc$Control = rowMeans(gdata_cc[,ctrlname, drop = FALSE])
gdata_cc$Treatment = rowMeans(gdata_cc[,treatname, drop = FALSE])

p1 = ScatterView(gdata_cc, "Control", "Treatment", label = "Gene", 
                 auto_cut_diag = TRUE, display_cut = TRUE, 
                 groups = c("top", "bottom")
                )
print(p1)
    l
    • 2
    • 5
  • m
    hi @Laurence Kuhlburger, thanks for the great job developing this pipeline! I am using it for some crispr screening analysis, and I would like to contribute .. I was thinking of adding two features that would help me doing my processing: 1. instead of providing both the library table (csv/tsv) and the relative fasta file for bowtie alignment, I would like to add a module to parse the table and produce the fasta automatically 2. I think it would be useful to have a parameter to inject custom arguments to the cutadapt trimming, in the style of what is currently implemented in the nf-core/rnaseq pipeline (e.g. https://nf-co.re/rnaseq/3.14.0/parameters/#extra_trimgalore_args) do you think these features could be useful?
    l
    • 2
    • 10
  • s
    This message was deleted.
    j
    • 2
    • 3
  • s
    Set up Bioconda channels:
    Copy code
    conda config --add channels bioconda
conda config --add channels conda-forge
conda config --set channel_priority strict
    See https://bioconda.github.io/#usage
  • c
    dplyr
    package error in conda env while running 
    test_screening
     Hi all, this could be a possible bug, I'm running the screening wf for the first time and I got the following error
    Copy code
    nextflow run nf-core/crisprseq -profile test_screening,conda --outdir results --analysis screening

 N E X T F L O W   ~  version 24.10.4

Launching `<https://github.com/nf-core/crisprseq>` [stoic_allen] DSL2 - revision: 0e9f915c4a [master]

WARN: Access to undefined parameter `reference_fasta` -- Initialise it to a default value eg. `params.reference_fasta = some_value`
WARN: ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
    There is a problem with your Conda configuration!
    You will need to set-up the conda-forge and bioconda channels correctly.
    Please refer to <https://bioconda.github.io/>
    The observed channel order is
    [conda-forge]
    but the following channel order is required:
    [conda-forge, bioconda]
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~"


------------------------------------------------------
                                        ,--./,-.
        ___     __   __   __   ___     /,-._.--~'
  |\ | |__  __ /  ` /  \ |__) |__         }  {
  | \| |       \__, \__/ |  \ |___     \`-._,-`-,
                                        `._,._,'
  nf-core/crisprseq 2.3.0
------------------------------------------------------
Input/output options
  input                     : <https://raw.githubusercontent.com/nf-core/test-datasets/crisprseq/testdata/samplesheet_test.csv>
  outdir                    : results
  analysis                  : screening

Screening parameters
  library                   : <https://raw.githubusercontent.com/nf-core/test-datasets/crisprseq/testdata/brunello_target_sequence.txt>
  contrasts                 : <https://raw.githubusercontent.com/nf-core/test-datasets/crisprseq/testdata/rra_contrasts.txt>
  mle                       : true
  rra                       : true
  bagel2                    : true
  drugz                     : true
  crisprcleanr              : Brunello_Library
  hitselection              : true
  hit_selection_iteration_nb: 50

Institutional config options
  config_profile_name       : Test screening profile
  config_profile_description: Minimal test dataset to check pipeline function

Core Nextflow options
  revision                  : master
  runName                   : stoic_allen
  launchDir                 : /home/chandini.v/nfcore-crisprseq
  workDir                   : /home/chandini.v/nfcore-crisprseq/work
  projectDir                : /home/chandini.v/.nextflow/assets/nf-core/crisprseq
  userName                  : chandini.v
  profile                   : test_screening,conda
  configFiles               : 

!! Only displaying parameters that differ from the pipeline defaults !!
------------------------------------------------------* The pipeline
  <https://doi.org/10.5281/zenodo.7598496>

* The nf-core framework
    <https://doi.org/10.1038/s41587-020-0439-x>

* Software dependencies
    <https://github.com/nf-core/crisprseq/blob/master/CITATIONS.md>

executor >  local (5)
[d1/87201e] process > NFCORE_CRISPRSEQ:CRISPRSEQ_SCREENING:FASTQC (SRR8983579)                            [100%] 2 of 2 ✔
[22/87a460] process > NFCORE_CRISPRSEQ:CRISPRSEQ_SCREENING:MAGECK_COUNT (control,treatment)               [100%] 1 of 1 ✔
[e6/2a0305] process > NFCORE_CRISPRSEQ:CRISPRSEQ_SCREENING:CRISPRCLEANR_NORMALIZE (count_table_normalize) [  0%] 0 of 1
[-        ] process > NFCORE_CRISPRSEQ:CRISPRSEQ_SCREENING:MAGECK_TEST                                    -
[-        ] process > NFCORE_CRISPRSEQ:CRISPRSEQ_SCREENING:MAGECK_GRAPHRRA                                -
[-        ] process > NFCORE_CRISPRSEQ:CRISPRSEQ_SCREENING:HITSELECTION_RRA                               -
[-        ] process > NFCORE_CRISPRSEQ:CRISPRSEQ_SCREENING:BAGEL2_FC                                      -
[-        ] process > NFCORE_CRISPRSEQ:CRISPRSEQ_SCREENING:BAGEL2_BF                                      -
[-        ] process > NFCORE_CRISPRSEQ:CRISPRSEQ_SCREENING:BAGEL2_PR                                      -
[-        ] process > NFCORE_CRISPRSEQ:CRISPRSEQ_SCREENING:BAGEL2_GRAPH                                   -
[-        ] process > NFCORE_CRISPRSEQ:CRISPRSEQ_SCREENING:HITSELECTION_BAGEL2                            -
[c2/b1cdd6] process > NFCORE_CRISPRSEQ:CRISPRSEQ_SCREENING:MATRICESCREATION (1)                           [100%] 1 of 1 ✔
[-        ] process > NFCORE_CRISPRSEQ:CRISPRSEQ_SCREENING:MAGECK_MLE                                     -
[-        ] process > NFCORE_CRISPRSEQ:CRISPRSEQ_SCREENING:HITSELECTION_MLE                               -
[-        ] process > NFCORE_CRISPRSEQ:CRISPRSEQ_SCREENING:MAGECK_FLUTEMLE_CONTRASTS                      -
[-        ] process > NFCORE_CRISPRSEQ:CRISPRSEQ_SCREENING:DRUGZ                                          -
[-        ] process > NFCORE_CRISPRSEQ:CRISPRSEQ_SCREENING:HITSELECTION                                   -
[-        ] process > NFCORE_CRISPRSEQ:CRISPRSEQ_SCREENING:VENNDIAGRAM                                    -
[-        ] process > NFCORE_CRISPRSEQ:CRISPRSEQ_SCREENING:VENNDIAGRAM_DRUGZ                              -
[-        ] process > NFCORE_CRISPRSEQ:CRISPRSEQ_SCREENING:MULTIQC                                        -
Execution cancelled -- Finishing pending tasks before exit
-[nf-core/crisprseq] Pipeline completed with errors-
ERROR ~ Error executing process > 'NFCORE_CRISPRSEQ:CRISPRSEQ_SCREENING:CRISPRCLEANR_NORMALIZE (count_table_normalize)'

Caused by:
  Process `NFCORE_CRISPRSEQ:CRISPRSEQ_SCREENING:CRISPRCLEANR_NORMALIZE (count_table_normalize)` terminated with an error exit status (1)


Command executed:

  #!/usr/bin/env Rscript
  library(CRISPRcleanR)
  library(dplyr)
  
  print('Brunello_Library')
  count_file <- read.delim('count_table.count.txt',header=T,sep = "	")
  count_file <-  count_file[!duplicated(count_file$sgRNA), ]
  if('' == "") {
      data('Brunello_Library')
      library <- as.data.frame(get('Brunello_Library'))
      #colnames(library)
      #print(head(count_file))
      #print(head(library))
      count_file_to_normalize <- count_file  %>% dplyr::left_join(library, by=c("sgRNA"="seq"),multiple = "all")
      count_file_to_normalize <- count_file_to_normalize %>% 
          dplyr::select(colnames(count_file),CODE,-sgRNA)
  
      names(count_file_to_normalize)[names(count_file_to_normalize) == 'Gene'] <- 'gene'
      names(count_file_to_normalize)[names(count_file_to_normalize) == 'CODE'] <- 'sgRNA'
      count_file_to_normalize <- count_file_to_normalize %>% dplyr::select(sgRNA, gene, everything())        
  } else {
      try(library <- read.delim('',header=T,sep = ","))
      duplicates <- duplicated(library[, 1])
      unique_rows <- !duplicates
      library <- library[unique_rows, , drop = FALSE]
      rownames(library) = library[,1]
      library = library[order(rownames(library)),]
      library = library[,-1]
      names(count_file)[names(count_file) == 'Gene'] <- 'gene'
      count_file_to_normalize <- count_file %>% dplyr::select(sgRNA, gene, everything())
      }
  
  normANDfcs <- ccr.NormfoldChanges(Dframe=count_file_to_normalize,saveToFig = FALSE,min_reads=30,EXPname="count_table_normalize", libraryAnnotation=library,display=FALSE)
  gwSortedFCs <- ccr.logFCs2chromPos(normANDfcs[["logFCs"]],library)
  correctedFCs <- ccr.GWclean(gwSortedFCs,display=FALSE,label='crisprcleanr')
  correctedCounts <- ccr.correctCounts('crisprcleanr',
                          normANDfcs[["norm_counts"]],
                          correctedFCs,
                          library,
                          minTargetedGenes=3,
                          OutDir='./')
  
  write.table(correctedCounts, file=paste0("crisprcleanr","_norm_table.tsv"),row.names=FALSE,quote=FALSE,sep="	")
  
  #version
  version_file_path <- "versions.yml"
  version_crisprcleanr <- paste(unlist(packageVersion("CRISPRcleanR")), collapse = ".")
  f <- file(version_file_path, "w")
  writeLines('"NFCORE_CRISPRSEQ:CRISPRSEQ_SCREENING:CRISPRCLEANR_NORMALIZE":', f)
  writeLines("    crisprcleanr: ", f, sep = "")
  writeLines(version_crisprcleanr, f)
  close(f)

Command exit status:
  1

Command output:
  (empty)

Command error:
  Loading required package: SummarizedExperiment
  Loading required package: MatrixGenerics
  Loading required package: matrixStats
  
  Attaching package: 'MatrixGenerics'
  
  The following objects are masked from 'package:matrixStats':
  
      colAlls, colAnyNAs, colAnys, colAvgsPerRowSet, colCollapse,
      colCounts, colCummaxs, colCummins, colCumprods, colCumsums,
      colDiffs, colIQRDiffs, colIQRs, colLogSumExps, colMadDiffs,
      colMads, colMaxs, colMeans2, colMedians, colMins, colOrderStats,
      colProds, colQuantiles, colRanges, colRanks, colSdDiffs, colSds,
      colSums2, colTabulates, colVarDiffs, colVars, colWeightedMads,
      colWeightedMeans, colWeightedMedians, colWeightedSds,
      colWeightedVars, rowAlls, rowAnyNAs, rowAnys, rowAvgsPerColSet,
      rowCollapse, rowCounts, rowCummaxs, rowCummins, rowCumprods,
      rowCumsums, rowDiffs, rowIQRDiffs, rowIQRs, rowLogSumExps,
      rowMadDiffs, rowMads, rowMaxs, rowMeans2, rowMedians, rowMins,
      rowOrderStats, rowProds, rowQuantiles, rowRanges, rowRanks,
      rowSdDiffs, rowSds, rowSums2, rowTabulates, rowVarDiffs, rowVars,
      rowWeightedMads, rowWeightedMeans, rowWeightedMedians,
      rowWeightedSds, rowWeightedVars
  
  Loading required package: Biobase
  Welcome to Bioconductor
  
      Vignettes contain introductory material; view with
      'browseVignettes()'. To cite Bioconductor, see
      'citation("Biobase")', and for packages 'citation("pkgname")'.
  
  
  Attaching package: 'Biobase'
  
  The following object is masked from 'package:MatrixGenerics':
  
      rowMedians
  
  The following objects are masked from 'package:matrixStats':
  
      anyMissing, rowMedians
  
  Loading required package: Rsubread
  Loading required package: Rqc
  Loading required package: ggplot2
  Loading required package: jsonlite
  Warning message:
  replacing previous import 'withr::makevars_user' by 'tools::makevars_user' when loading 'CRISPRcleanR' 
  Error in library(dplyr) : there is no package called 'dplyr'
  Execution halted

Work dir:
  /home/chandini.v/nfcore-crisprseq/work/e6/2a03058de72bb4e4cadc46c09b6047

Tip: you can replicate the issue by changing to the process work dir and entering the command `bash .command.run`

 -- Check '.nextflow.log' file for details
ERROR ~ Pipeline failed. Please refer to troubleshooting docs: <https://nf-co.re/docs/usage/troubleshooting>

 -- Check '.nextflow.log' file for details
    l
    • 2
    • 3
  • s
    Set up Bioconda channels:
    Copy code
    conda config --add channels bioconda
conda config --add channels conda-forge
conda config --set channel_priority strict
    See https://bioconda.github.io/#usage
  • m
    @Júlia Mir I have put you as reviewer of PR 237 https://github.com/nf-core/crisprseq/pull/237, can you take a look at the code, when you have time? please, let me know if there is anything I should change/add! thanks
    j
    • 2
    • 2
  • m
    Hi @Júlia Mir @Laurence Kuhlburger, brief recap on where we stand for the upcoming release: • PR #237 (custom trimming options) is ready for review, could you please take a look and let me know if this can be merged? • PR #239 (test conversion to nf-test), I started this during the hackathon, but some tests are lengthy and I had also other things to do, so the assertion statements are still to do, I will try to complete this as soon as possible, and then if you agree I will change the CI gh workflow to use nf-test instead of the test profiles • PR #235 (the issue with the conda env), I have read your discussion on the PR... is there really something to fix here? • issue #240 (additinal test for bowtie alignment), if I am not mistaken, this is not covered currently in tests, so I will do this when I finish PR #239 • other issues?
    l
    j
    • 3
    • 8
  • a
    Dear #C03PADVJ8RL users, I was wondering if nf-core/crisprseq can run the "targeted" analyses with many e.g., n=50 targets. With the provided example samplesheet, it seems that we can run for 1 target/protospacer and many samples. My use-case is kind of the opposite: i.e., one/few samples but many targets. Thanks for the help 😉
    j
    • 2
    • 7
  • k
    Hi all, my colleague just tried this pipeline and we are troubleshooting as the Mageck MLE doesn't run with negative control sgRNA. It seems like CRISPRcleanR removed the counts of the non-target control sgRNAs and an error showed up. Is it not meant to run with the non-target control after normalisation or is there anything else we can do to resolve the issue? Really appreciate any help!
    j
    • 2
    • 8
  • a
    Hi All. I have tried to run crispr-seq pipeline and I was able to get the mageck mle data but after that the pipeline breaks. I tried different ways to address the errors but no luck; here's the summary of the error- nf-core/crisprseq pipeline is failing at the final step (MAGECK_FLUTEMLE) due to a SSL certificate verification error when trying to download a Singularity container. 1. Container Download Timeout- ◦ 20-minute timeout when trying to pull the bioconductor-mageckflute container ◦ This happens even when using 
    --skip_mageckflute
    flag 2. System Compatibility? ◦ Using Nextflow version 25.04.4 steps completed successfully: • FASTQC • MAGECK_COUNT • MAGECK_MLE_MATRIX What's Missing: MAGECK_FLUTEMLE step (visualization and additional analysis) error-
    Copy code
    [7f/5646e5] NFC…:FASTQC (1-GFAP-WT-PP-PRE) | 4 of 4, cached: 4 ✔
[e2/2a2daa] NFC…_COUNT (PRE,PRE,POST,POST) | 1 of 1, cached: 1 ✔
[ee/e62498] NFC…MLE_MATRIX (design_matrix) | 1 of 1, cached: 1 ✔
[-        ] NFC…_SCREENING:MAGECK_FLUTEMLE -
[-        ] NFC…RISPRSEQ_SCREENING:MULTIQC -
Pulling Singularity image <https://depot.galaxyproject.org/singularity/bioconductor-mageckflute:2.6.0--r43hdfd78af_0> [cache /hpc/crispr-screen-jun18/work/singularity/depot.galaxyproject.org-singularity-bioconductor-mageckflute-2.6.0--r43hdfd78af_0.img]
WARN: Singularity cache directory has not been defined -- Remote image will be stored in the path: /hpc/crispr-screen-jun18/work/singularity -- Use the environment variable NXF_SINGULARITY_CACHEDIR to specify a different location
ERROR ~ Error executing process > 'NFCORE_CRISPRSEQ:CRISPRSEQ_SCREENING:MAGECK_FLUTEMLE (1)'

Caused by:
  Failed to pull singularity image
    command: singularity pull  --name depot.galaxyproject.org-singularity-bioconductor-mageckflute-2.6.0--r43hdfd78af_0.img.pulling.1750968555251 <https://depot.galaxyproject.org/singularity/bioconductor-mageckflute:2.6.0--r43hdfd78af_0> > /dev/null
    status : 255
    hint   : Try and increase singularity.pullTimeout in the config (current is "20m")
    message:
      FATAL:   Error making http request: Head "<https://depot.galaxyproject.org/singularity/bioconductor-mageckflute:2.6.0--r43hdfd78af_0>": tls: failed to verify certificate: x509: certificate signed by unknown authority

 -- Check '.nextflow.log' file for details
ERROR ~ Pipeline failed. Please refer to troubleshooting docs: <https://nf-co.re/docs/usage/troubleshooting>

 -- Check '.nextflow.log' file for details
-[nf-core/crisprseq] Pipeline completed with errors-
    i tried : --skip_mageckflute and
    Copy code
    nextflow run nf-core/crisprseq -r dev \
--input samplesheet.csv \
--mle_design_matrix design_matrix.txt \
--library PP_library_fixed.tsv \
--analysis screening \
--outdir output \
-profile singularity \
-with-singularity {--nohttps} \
-resume \
-config <(echo "singularity { pullTimeout = '5h' }")
    current command that got me the above outputs is- 
    command: nextflow run nf-core/crisprseq -r dev --input samplesheet.csv --mle_design_matrix design_matrix.txt --library PP_library_fixed.tsv --analysis screening  --outdir output -profile standard -resume
    How can i fix this? thank you in advance!
    m
    • 2
    • 6
  • s
    Hi @Júlia Mir, Thanks for the input on crispresso2 pipeline. I am happy to collaborate on integrating crispresso2 to crisprseq pipeline. https://github.com/nf-core/proposals/issues/75. please let me know how to proceed on this. https://github.com/sathyasjali/nf-core-crispresso
    j
    • 2
    • 7
  • j
    <!channel> (the topic is important enough for a channel ping) I've had a pipeline logo in my computer for some years, but now thanks to @James Fellows Yates it became a nice sticker style logo 🥳 I would love to have your opinions! And ✅ if you want to see it as the official pipeline logo!
    nfcore-crisprseq-logo-hex-dark.svg
    nfcore-crisprseq-logo-hex-light.svg
    ✅ 7
    ✔️ 5
    ☑️ 4
    checked 4
    ❤️ 3
    j
    • 2
    • 2
  • j
    Hey guys, is there a reason that crisprseq using MAGeCK RRA does not allow for setting --paired ? Or did I just miss it
    m
    • 2
    • 4
  • j
    Could it be that --mle , contrasts and --publish_dir_mode move is broken? I have 4 different contrasts defined as 4 different rows in the same file, which all work fine with RRA. When I use mle everything is fine as well, except for that it only ever outputs a random contrast out of the contrasts file (I assume). When I then turn on --publish_dir_mode move to test if it changes sth, I get an error. Can MLE only run on one contrast as opposed to rra?
    m
    • 2
    • 42
  • m
    👋 Hi everyone, following the discussion in PR #260, we’re considering a possible change in how contrast files are handled in the 
    nf-core/crisprseq
    pipeline, for the screening analysis. Currently, the contrast file can refer either to conditions or to samples, depending on the context (e.g. when using precomputed count tables). One proposed simplification would be to remove the “condition” column entirely and make the contrast file always refer to samples. This would make the behavior more consistent across cases, though it might slightly reduce readability and would be a breaking change compared to previous releases. What do you think? Please vote with an emoji or share your thoughts below! • 👍 = I support simplifying and using samples only • 🤔 = I’m unsure / need to understand implications • 👎 = I’d prefer keeping the current approach
    👍🏻 1
    🤔 1
    👎🏻 1
    👍 3
    j
    j
    m
    • 4
    • 6
  • j
    ☝🏻 <!channel> if you are using this pipeline for screening analysis, please vote! This will be a breaking change to the pipeline if we go for it 🙂
  • k
    Hi! This is a CRISPR KO screen analysis-related question. I was using the crisprseq pipeline as a reference. I saw that it uses crisprcleaneR for CNV correction and normalization. I am not using it in my analysis; I am using the Mageck MLE's parameter (--cnv-norm) directly. If anyone has any insight into when to use crisprcleaneR instead of just using the default Mageck MLE option, I'd like to discuss. Secondly, if anyone has used Mageck MLE's option to perform CNV correction, I'd like to confirm the format of the matrix file from DepMap, as it has released updated files. Thank you for the help! -Kalyanee
    m
    • 2
    • 1
  • p
    Hello there, I tried to run bowtie2 mapping by specifying the --fasta parameter with a library file in fasta format. However, I got the error message "Process NFCORE_CRISPRSEQCRISPRSEQ SCREENINGBOWTIE2_ALIGN declares 5 input channels but 4 were specified". How should I fix this? Many thanks!
    j
    m
    • 3
    • 7
  • m
    Hi everyone! I’m running nf-core/crisprseq (2.4.0dev) in screening mode and I’m getting a consistent failure at the MAGECK_COUNT step with my paired end sequencing. The error is
    Copy code
    ERROR ~ Error executing process > 
NFCORE_CRISPRSEQ:CRISPRSEQ_SCREENING:MAGECK_COUNT

ERROR: Cannot automatically determine the --trim-5 length.
Only 0.0439 % of the reads can be identified.
(exit status 255)
    From the MAGeCK logs: • R1: mapping looks fine (~93% in trim test) • R2: almost no reads are identified during trim-5 auto-detection I also tried with cutadapter like in below
    Copy code
    nextflow run crisprseq \                       
  --analysis screening \
  --input /Users/metinyazar/Desktop/nf_core/bond_group/crisprseq_results/MS1943_vs_UNC6852/samplesheet.csv \
  --library /Users/metinyazar/Desktop/nf_core/bond_group/crisprseq_results/MS1943_vs_UNC6852/library_fixed.tsv \
  --outdir /Users/metinyazar/Desktop/nf_core/bond_group/crisprseq_results/MS1943_vs_UNC6852/MS1943_vs_UNC6852_results \
  --contrasts /Users/metinyazar/Desktop/nf_core/bond_group/crisprseq_results/MS1943_vs_UNC6852/rra_contrasts.txt \
  --rra \
  --drugz \
  --bagel2 \
  --mle \
  --hitselection \
  --drugz_remove_genes "luciferase,LacZ,EGFP,Non_Targeting_Control" \
  --three_prime_adapter AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC \
  --extra_cutadapt_three_prime_args "-A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT" \
  -profile docker \
  -c /Users/metinyazar/Desktop/nf_core/bond_group/crisprseq_results/MS1943_vs_UNC6852/user.config
    It is still giving similiar error. Never done paired one before. How should I fix this? Thank you!
    m
    • 2
    • 4
  • m
    Hello everyone! I have a question about BAGEL2 analysis in crisprseq. I have two biological replicates of two samples and this is my contrast file 
    reference;treatment
    Day0_1,Day0_2;Untreated_1,Untreated_2
    When I perform the analysis with nf-core/crisprseq (2.4.0dev), BAGEL2 calculates fold change by using reference column Day0_1 (not Day0_2). But if I do this analysis with nf-core/crisprseq (2.3.0), the fold changes are instead calculated using the mean of Day0_1 and Day0_2 as the reference. I couldn't decide which one is true (the mean-based approach seems incorrect to me) Could this be a bug? How should I fix this? Many thanks.
    m
    • 2
    • 2
  • r
    @Júlia Mir i am struggeling to finish running the full size tests for crisprseq: https://cloud.seqera.io/orgs/nf-core/workspaces/AWSmegatests/watch/2uuonAhYHuFuvD/v2/tasks seems like multiqc is running endlessly. What is the expected runtime on a local cluster?
    j
    • 2
    • 5
  • l
    Hello there, any solutions to the Java date function error? I'm using the latest version of nextflow, I see that the error is on row 256 of 
    nextflow.config
    . I was thinking about fixing it by myself by adding it to params but before I wanted to ask you if there was already an updated version of the pipeline. Thanks!
    Copy code
    Pulling nf-core/crisprseq:2.3.0 ...
WARN: Cannot read project manifest -- Cause:  Config parsing failed
 downloaded from <https://github.com/nf-core/crisprseq.git>
Error nextflow.config:256:1: Variable declarations cannot be mixed with config statements
│ 256 | def trace_timestamp = new java.util.Date().format( 'yyyy-MM-dd_HH-mm-s
╰     | ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^


ERROR ~ Config parsing failed
    m
    • 2
    • 1